Review



poly(didc) poly(di-dc  (Amersham Pharmacia Biotech Ltd)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Amersham Pharmacia Biotech Ltd poly(didc) poly(di-dc
    Poly(didc) Poly(di Dc, supplied by Amersham Pharmacia Biotech Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/poly+didc/pm17462468-114-23-25
    Average 90 stars, based on 1 article reviews
    poly(didc) poly(di-dc - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Incubation:

    Article Title: Sphingosine-1-phosphate inhibits nuclear factor kappaB activation and germ cell apoptosis in the human testis independently of its receptors.
    Article Snippet: The NF- B and AP-1 DNA-binding activities were assayed with DNA probes containing the consensus B enhancer element 5 AGTTGAGGGGACTTTCCCAGGC3 (sc-2505; Santa Cruz) or the consensus AP-1 site 5 GATCTATCTGAGTCAGCAG-3.23 The probes were 5 end-labeled with [ -32P] ATP using polynucleotide kinase (Promega Corp., Madison, WI). .. Nuclear protein extracts (10 g) were incubated on ice for 10 minutes with 2 g poly(dIdC)(di-dC) (Amersham Pharmacia Biotech, Piscataway, NJ) in 50 mmol/L HEPES, (pH 7.6), 10% glycerol v/v, 225 mmol/L KCl, 1 mmol/L ethylenediaminetetraacetic acid, 2.5 mmol/L dithiothreitol, 1 mmol/L MgCl2, 0.75 mmol/L phenylmethylsulfonyl fluoride, and 1.5 mol/L leupeptin. ..

    Article Title: Activator protein-1 in human male germ cell apoptosis.
    Article Snippet: Laura Suomalainen, Leo Dunkel, Ilkka Ketola, Minna Eriksson, Krista Erkkilä, Riina Oksjoki, Kimmo Taari, Markku Heikinheimo and Virve Pentikäinen Programme for Developmental and Reproductive Biology, Biomedicum Helsinki and Hospital for Children and Adolescents, University of Helsinki, FIN-00029, Helsinki, Molecular Cancer Biology Research Program, Biomedicum Helsinki, University of Helsinki, FIN-00014, Helsinki, Wihuri Research Institute, Helsinki, Department of Urology, Helsinki University Central Hospital, Helsinki, and Kuopio University Central Hospital, Kuopio, Finland To whom correspondence should be addressed at: Hospital for Children and Adolescents, University of Helsinki, Biomedicum Helsinki, Haartmaninkatu 8, 5 krs B529b, PO Box 700, FIN-00029, Helsinki, Finland.. E-mail: laura.suomalainen@hus.fi



    Similar Products

    poly (di-dc) x poly (didc)  (Promega)
    90
    Promega poly (di-dc) x poly (didc)
    Poly (Di Dc) X Poly (Didc), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/poly++di+dc++x+poly++didc+/pmc06053526-243-39-42
    Average 90 stars, based on 1 article reviews
    poly (di-dc) x poly (didc) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    poly(didc)·poly(di−dc  (Millipore)
    90
    Millipore poly(didc)·poly(di−dc
    Poly(didc)·Poly(di−Dc, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/poly+didc+%C2%B7poly+di+dc/pmc04763160-185-31-32
    Average 90 stars, based on 1 article reviews
    poly(didc)·poly(di−dc - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    poly(di-dc)-poly(didc  (Promega)
    90
    Promega poly(di-dc)-poly(didc
    Poly(di Dc) Poly(didc, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/poly+di+dc+/pm22859272-40-35-38
    Average 90 stars, based on 1 article reviews
    poly(di-dc)-poly(didc - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    poly(didc) · (di-dc  (Millipore)
    90
    Millipore poly(didc) · (di-dc
    Poly(didc) · (Di Dc, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/poly+didc/10__1042_slash_bj20091578-266-11-17
    Average 90 stars, based on 1 article reviews
    poly(didc) · (di-dc - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    didc, i.e., poly(di-dc)-poly(di-dc)  (Thermo Fisher)
    90
    Thermo Fisher didc, i.e., poly(di-dc)-poly(di-dc)
    Didc, I.E., Poly(di Dc) Poly(di Dc), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/10__1016_slash_j__chroma__2008__06__020-56-10-13
    Average 90 stars, based on 1 article reviews
    didc, i.e., poly(di-dc)-poly(di-dc) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    poly(didc) poly(di-dc  (Millipore)
    90
    Millipore poly(didc) poly(di-dc
    Poly(didc) Poly(di Dc, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/poly+didc/10__1074_slash_jbc__m610108200-108-26-28
    Average 90 stars, based on 1 article reviews
    poly(didc) poly(di-dc - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    poly(didc) poly(di-dc  (Amersham Pharmacia Biotech Ltd)
    90
    Amersham Pharmacia Biotech Ltd poly(didc) poly(di-dc
    Poly(didc) Poly(di Dc, supplied by Amersham Pharmacia Biotech Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/poly+didc/pm17462468-114-23-25
    Average 90 stars, based on 1 article reviews
    poly(didc) poly(di-dc - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    poly(di-dc)·poly(didc)  (Amersham Life Sciences Inc)
    90
    Amersham Life Sciences Inc poly(di-dc)·poly(didc)
    Poly(di Dc)·Poly(didc), supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/poly+dg+dc+/pm16962936-91-13-14
    Average 90 stars, based on 1 article reviews
    poly(di-dc)·poly(didc) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    poly(di-dc)-poly(didc  (Millipore)
    90
    Millipore poly(di-dc)-poly(didc
    Poly(di Dc) Poly(didc, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/poly++di+dc/pm16878996-142-64-65
    Average 90 stars, based on 1 article reviews
    poly(di-dc)-poly(didc - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    poly didc di dc  (Amersham Pharmacia Biotech Ltd)
    86
    Amersham Pharmacia Biotech Ltd poly didc di dc
    Poly Didc Di Dc, supplied by Amersham Pharmacia Biotech Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/poly+didc+di+dc/dc+di+poly/pm15299089-69-14-16
    Average 86 stars, based on 1 article reviews
    poly didc di dc - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results